px919557
Joined: 29 Jul 2010
Posts: 236
Read: 0 topics
Warns: 0/5
Location: qefrqn
|
 Posted: Thu 14:41, 03 Mar 2011 Post subject: asics shoes online Chinese local strains of human |
|
|
Chinese local strains of human papillomavirus type 16 E7 gene in primary structure and ...
d Ⅱ site reorganization. The transformation and screening, high expression of recombinant plasmid of Microbiology and Immunology November 1996 Volume 16 No. 6 tablets: pWHPV] 6E7 a HB. To confirm that E7 gene and expression vector pWR590-1 reorganization to pWHPV16E7 a HB as a template. HPV16E7 genes with positive and negative PCR amplification primers, the specificity was about 0.3kb DNA amplification band; but with pWR590-1 as a template, no DNA amplification of the corresponding band appears. Therefore,[link widoczny dla zalogowanych], high expression of recombinant plasmid proved true with a HB HPV16E7 order. ATGCATGGAGATACACCTACATTOCATC, AATAT Xie Ⅲ dG ',[link widoczny dla zalogowanych], oftheexpressonpro-duct1EcoilJMi09; 2.EcoliJM1O9trapsformedwithpWR590-1I3EcoliJM109transformedwithrecombinantpl handsome {4.E.JM109,[link widoczny dla zalogowanych], afterinducedbyIPTGI5.ErJM109 + pWR590-1 (after ~ nduc ~); 6.recombinantplasmJd (afterinduee) {M. Proteinnmlecularweightmarkers... cATT fan TGCCCCATCTGTTCTCG from CCATAt. .. tefmj mouth Ⅱ 1codon HPV16E7 Solid 2 nucleotide sequence of strains in Hubei (uplink) and the deduced amino acid sequence sub (downstream) F_ cried 2.Nucleotldesequence (above) anddeducedaminoacidsequence (below) oftheChineseHPV16E7-HBThecompletenueleotidesequenceofE7DNAisshownin (+) ... IndlcatmutaIIonnllckot [de () 4. plasmid expression in Escherichia coli: the recombinant plasmid was transformed into E. coli JMlo9,[link widoczny dla zalogowanych], made after SDSPAGE analysis of induction by IPTG, the recombinant plasmid with HB HPV16E7 a lysate of bacteria there was a darker color The molecular weight of about 69 × 10.'s new protein band. presumed galactosidase HPV16E7 a residue of a protein HB financial units. molecular weight consistent with the theoretical value. that p-galactosidase protein molecular weight of 64 × 10 . HPV16E7 HB protein of a molecular weight of 4.6 × 10 (Figure 3). with a dual wavelength scanner to scan the gel,[link widoczny dla zalogowanych], the relative peak area under the scan shows. induced total bacterial protein fusion protein to 30 or so. 400 expression products solid 4 SDS-PAGE TLC Rights 4.Thin-layerscanningoftheSDS-PAGEsep-arated and its encoded protein HPV16E7 discussion of important biological functions. American scholars from the bovine papillomavirus (BPV) E7 gene was isolated and cloned later used to produce vaccines, found that the vaccine can prevent cervical cancer similar to human tumors in cattle.; Chen HPV16E7 other proteins encoded by the transfection of mouse fibroblast and melanoma cells, and used to immune mice with the gene found in mice body produced specific antibodies, the transplanted melanoma rejection in two weeks.. These facts suggest that HPV16 epidemic through the use of
More articles related to topics：
asics tiger shoes Neutrophil killing hemorrhagic f
clarks shoes outlet Gender, age, height and weight
[link widoczny dla zalogowanych]
The post has been approved 0 times
|
|
